Comparative genomics

Results: 274



#Item
41Biology / Bioinformatics / Genomics / Genetics / Computational phylogenetics / Biological databases / BLOSUM / Genome / AhoCorasick algorithm / GenBank / BLAST / Arabidopsis

E MBARRASSMENT OF R ICHES C HALLENGES Indexes in Comparative Genomics Bernhard Haubold

Add to Reading List

Source URL: guanine.evolbio.mpg.de

Language: English - Date: 2010-11-09 12:07:10
42Biology / Genetics / Genomics / Bioinformatics / Human genome / Whole genome sequencing / Genome / ENCODE / Comparative genomics / Genome browser

Hurdles for Genomic Data Usage Management (Position Paper) Muhammad Naveed University of Illinois at Urbana-Champaign www.cryptoonline.com

Add to Reading List

Source URL: web.engr.illinois.edu

Language: English - Date: 2014-05-08 03:51:20
43

Comparative and Functional Genomics Comp Funct Genom 2003; 4: 194–202. Published online 1 April 2003 in Wiley InterScience (www.interscience.wiley.com). DOI: cfg.260 Featured Organism

Add to Reading List

Source URL: www.compsysbio.org

Language: English - Date: 2012-03-09 15:07:06
    44Biology / Genomics / Genetics / Statistical genetics / Evolutionary biology / Philosophy of biology / Population genetics / Computational genomics / Population genomics / Bioinformatics / Book:Genetics / Outline of evolution

    Cornell courses relevant to Population, Comparative & Evolutionary Genomics Assembled by the Cornell Center for Comparative and Population Genomics (http://3cpg.cornell.edu) Available as a PDF downloadable from

    Add to Reading List

    Source URL: 3cpg.cornell.edu

    Language: English - Date: 2016-01-06 14:21:01
    45Biology / Genomics / Genetics / Molecular evolution / Genetic mapping / Bioinformatics / Genome / Evolution / Comparative genomics / Horizontal gene transfer / Gene duplication / Gene

    Scientific Report First name / Family name Nationality Name of the Host Organisation First Name / family name

    Add to Reading List

    Source URL: fellowship.ercim.eu

    Language: English - Date: 2013-02-11 08:41:46
    46Biology / Genetics / Bioinformatics / Genomics / Genetic mapping / Human evolution / Human genetics / Human genome / Conserved sequence / Noncoding DNA / Genome / Comparative genomics

    GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAA

    Add to Reading List

    Source URL: bejerano.stanford.edu

    Language: English - Date: 2009-04-17 16:28:41
    47

    Comparative Population Genomics of the Ejaculate in Humans and the Great Apes Jeffrey M. Good,*,1,2 Victor Wiebe,1 Frank W. Albert,z,1 Herna´n A. Burbano,§,1 Martin Kircher,k,1 Richard E. Green,ô,1 Michel Halbwax,#,1

    Add to Reading List

    Source URL: frankwalbert.bol.ucla.edu

    Language: English - Date: 2013-11-12 19:05:34
      48

      3-way Networks: Application of Hypergraphs for Modelling Increased Complexity in Comparative Genomics

      Add to Reading List

      Source URL: bioenergycenter.org

      Language: English - Date: 2015-04-07 14:05:41
        49Biology / Genetics / Genomics / DNA / Molecular biology / Genome / Comparative genomics / Noncoding DNA / Intron / Exon / Molecular evolution / Bioinformatics

        Genome Indices database 1 Integration of Biological Features of Multiple Genomes - The Construction of “Genome Indices” database Shujiro Okuda

        Add to Reading List

        Source URL: www.jsbi.org

        Language: English - Date: 2004-06-07 22:06:09
        50Genomics / Genetics / Biology / Omics / Metagenomics / Transcriptome / Comparative genomics / Bioinformatics / Population genomics / Genome / Molecular evolution

        workshop on genomics europe 2012 Monday, January 9, 12

        Add to Reading List

        Source URL: evomicsorg.wpengine.netdna-cdn.com

        Language: English - Date: 2012-01-09 14:20:08
        UPDATE